After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

pCMV3-C-HA Negative Control Vector (C-terminal HA-tagged)

DatenblattBewertungenÄhnliche ProdukteProtokolle
  • Negative control for the pCMV3-C-HA clone.
  • sVector sequence is the same as pCMV3-C-HA, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-HA-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-HA-NCV
 Vector Size

6016bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag HA
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-HA-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Katalog: CV013
Listenpreis: 
Preis:      (You Save: )
Menge:+-
Verfügbarkeit5 Business days
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“