GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11017-M-F

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GPR56 Reagents

CRO Services


All GPR56 Reagents

GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 996T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human G protein-coupled receptor 56 with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XbaI (5.4kb + 2.13kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPR56 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human GPR56 Gene Expression validated Image 1686
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human FANCG/FAG Gene Plasmid Map 7220

GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

BFPP cDNA ORF Clone, Human;DKFZp781L1398 cDNA ORF Clone, Human;TM7LN4 cDNA ORF Clone, Human;TM7XN1 cDNA ORF Clone, Human;UNQ540/PRO1083 cDNA ORF Clone, Human

GPR56 Background Information

GPR56 is a member of an adhesion G protein-coupled receptor family with a very long N-terminal stalk and seven transmembrane domains. GPR56 may be a target for the treatment of type 2 diabetes. GPR56 inhibits melanoma metastatic growth by impeding the expansion of micrometastases to macrometastases. GPR56 loss of function promotes mesenchymal differentiation and radioresistance of glioma initiating cells both in vitro and in vivo.
Full Name
adhesion G protein-coupled receptor G1
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.
  • GPR56 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Mouse MG59593-U
    GPR56 cDNA ORF Clone in Cloning Vector, Mouse MG50335-M
    GPR56 cDNA ORF Clone, Mouse, untagged MG59593-UT
    GPR56 cDNA ORF Clone, Mouse, untagged MG50335-UT
    GPR56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59593-ACG
    GPR56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACGLN
    GPR56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59593-ACGLN
    GPR56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACG
    GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50335-ACR
    GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59593-ACR
    GPR56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50335-CF
    GPR56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59593-CF
    GPR56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59593-NF
    GPR56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50335-NF
    GPR56 cDNA ORF Clone, Mouse, C-His tag MG50335-CH
    GPR56 cDNA ORF Clone, Mouse, C-His tag MG59593-CH
    GPR56 cDNA ORF Clone, Mouse, N-His tag MG59593-NH
    GPR56 cDNA ORF Clone, Mouse, N-His tag MG50335-NH
    GPR56 cDNA ORF Clone, Mouse, C-HA tag MG59593-CY
    GPR56 cDNA ORF Clone, Mouse, C-HA tag MG50335-CY
    GPR56 cDNA ORF Clone, Mouse, N-HA tag MG50335-NY
    GPR56 cDNA ORF Clone, Mouse, N-HA tag MG59593-NY
    GPR56 cDNA ORF Clone, Mouse, C-Myc tag MG50335-CM
    GPR56 cDNA ORF Clone, Mouse, C-Myc tag MG59593-CM
    GPR56 cDNA ORF Clone, Mouse, N-Myc tag MG50335-NM
    GPR56 cDNA ORF Clone, Mouse, N-Myc tag MG59593-NM
    GPR56 qPCR Primer Pairs, Mouse MP200358

    GPR56 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Human HG11017-M
    GPR56 cDNA ORF Clone in Cloning Vector, Human HG18697-U
    GPR56 cDNA ORF Clone, Human, untagged HG11017-UT
    GPR56 cDNA ORF Clone, Human, untagged HG18697-UT
    GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18697-ACGLN
    GPR56 cDNA ORF Clone, Human, C-GFPSpark® tag HG18697-ACG
    GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACGLN
    GPR56 cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACG
    GPR56 cDNA ORF Clone, Human, C-OFPSpark® tag HG11017-ACR
    GPR56 cDNA ORF Clone, Human, C-OFPSpark® tag HG18697-ACR
    GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11017-CF
    GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18697-CF
    GPR56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18697-NF
    GPR56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11017-NF
    GPR56 cDNA ORF Clone, Human, C-His tag HG11017-CH
    GPR56 cDNA ORF Clone, Human, C-His tag HG18697-CH
    GPR56 cDNA ORF Clone, Human, N-His tag HG18697-NH
    GPR56 cDNA ORF Clone, Human, N-His tag HG11017-NH
    GPR56 cDNA ORF Clone, Human, C-HA tag HG18697-CY
    GPR56 cDNA ORF Clone, Human, C-HA tag HG11017-CY
    GPR56 cDNA ORF Clone, Human, N-HA tag HG11017-NY
    GPR56 cDNA ORF Clone, Human, N-HA tag HG18697-NY
    GPR56 cDNA ORF Clone, Human, C-Myc tag HG18697-CM
    GPR56 cDNA ORF Clone, Human, C-Myc tag HG11017-CM
    GPR56 cDNA ORF Clone, Human, N-Myc tag HG18697-NM
    GPR56 cDNA ORF Clone, Human, N-Myc tag HG11017-NM
    GPR56 qPCR Primer Pairs, Human HP100978
    info info
    添加购物车成功! 添加购物车失败!