GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11017-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GPR56 Reagents
CRO Services

All GPR56 Reagents
GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 996T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human G protein-coupled receptor 56 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XbaI (5.4kb + 2.13kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GPR56 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human GPR56 Gene Expression validated Image 1686
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human FANCG/FAG Gene Plasmid Map 7220
GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BFPP cDNA ORF Clone, Human;DKFZp781L1398 cDNA ORF Clone, Human;TM7LN4 cDNA ORF Clone, Human;TM7XN1 cDNA ORF Clone, Human;UNQ540/PRO1083 cDNA ORF Clone, Human
GPR56 Background Information
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.
  • GPR56 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Mouse MG50335-M
    GPR56 cDNA ORF Clone, Mouse, untagged MG50335-UT
    GPR56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACGLN
    GPR56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACG
    GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50335-ACR
    GPR56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50335-CF
    GPR56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50335-NF
    GPR56 cDNA ORF Clone, Mouse, C-His tag MG50335-CH
    GPR56 cDNA ORF Clone, Mouse, N-His tag MG50335-NH
    GPR56 cDNA ORF Clone, Mouse, C-HA tag MG50335-CY
    GPR56 cDNA ORF Clone, Mouse, N-HA tag MG50335-NY
    GPR56 cDNA ORF Clone, Mouse, C-Myc tag MG50335-CM
    GPR56 cDNA ORF Clone, Mouse, N-Myc tag MG50335-NM
    GPR56 qPCR Primer Pairs, Mouse MP200358

    GPR56 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Human HG11017-M
    GPR56 cDNA ORF Clone, Human, untagged HG11017-UT
    GPR56 cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACG
    GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACGLN
    GPR56 cDNA ORF Clone, Human, C-OFPSpark® tag HG11017-ACR
    GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11017-CF
    GPR56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11017-NF
    GPR56 cDNA ORF Clone, Human, C-His tag HG11017-CH
    GPR56 cDNA ORF Clone, Human, N-His tag HG11017-NH
    GPR56 cDNA ORF Clone, Human, C-HA tag HG11017-CY
    GPR56 cDNA ORF Clone, Human, N-HA tag HG11017-NY
    GPR56 cDNA ORF Clone, Human, C-Myc tag HG11017-CM
    GPR56 cDNA ORF Clone, Human, N-Myc tag HG11017-NM
    GPR56 qPCR Primer Pairs, Human HP100978
    info info
    添加购物车成功! 添加购物车失败!