XPNPEP1 cDNA ORF Clone, Human, untagged

Cat: HG10553-M-N

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All XPNPEP1 Reagents

CRO Services


All XPNPEP1 Reagents

XPNPEP1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1872 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human X-prolyl aminopeptidase (aminopeptidase P) 1, soluble DNA.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XbaI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

XPNPEP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XPNPEP1 cDNA ORF Clone, Human, untagged Alternative Names

APP1 cDNA ORF Clone, Human;SAMP cDNA ORF Clone, Human;XPNPEP cDNA ORF Clone, Human;XPNPEPL cDNA ORF Clone, Human;XPNPEPL1 cDNA ORF Clone, Human

XPNPEP1 Background Information

Full Name
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

XPNPEP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Rat RG81201-U
XPNPEP1 cDNA ORF Clone, Rat, untagged RG81201-UT
XPNPEP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81201-ACGLN
XPNPEP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81201-ACG
XPNPEP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81201-ANG
XPNPEP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81201-ACR
XPNPEP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81201-ANR
XPNPEP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81201-CF
XPNPEP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81201-NF
XPNPEP1 cDNA ORF Clone, Rat, C-His tag RG81201-CH
XPNPEP1 cDNA ORF Clone, Rat, N-His tag RG81201-NH
XPNPEP1 cDNA ORF Clone, Rat, C-HA tag RG81201-CY
XPNPEP1 cDNA ORF Clone, Rat, N-HA tag RG81201-NY
XPNPEP1 cDNA ORF Clone, Rat, C-Myc tag RG81201-CM
XPNPEP1 cDNA ORF Clone, Rat, N-Myc tag RG81201-NM
XPNPEP1 qPCR Primer Pairs, Rat RP301157

XPNPEP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Mouse MG50798-G
XPNPEP1 cDNA ORF Clone, Mouse, untagged MG50798-UT
XPNPEP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50798-ACG
XPNPEP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50798-ACGLN
XPNPEP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50798-ANG
XPNPEP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50798-ACR
XPNPEP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50798-ANR
XPNPEP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50798-CF
XPNPEP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50798-NF
XPNPEP1 cDNA ORF Clone, Mouse, C-His tag MG50798-CH
XPNPEP1 cDNA ORF Clone, Mouse, N-His tag MG50798-NH
XPNPEP1 cDNA ORF Clone, Mouse, C-HA tag MG50798-CY
XPNPEP1 cDNA ORF Clone, Mouse, N-HA tag MG50798-NY
XPNPEP1 cDNA ORF Clone, Mouse, C-Myc tag MG50798-CM
XPNPEP1 cDNA ORF Clone, Mouse, N-Myc tag MG50798-NM
XPNPEP1 qPCR Primer Pairs, Mouse MP200769

XPNPEP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Human HG10553-M
XPNPEP1 cDNA ORF Clone, Human, untagged HG10553-UT
XPNPEP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10553-ACGLN
XPNPEP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10553-ACG
XPNPEP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10553-ANG
XPNPEP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10553-ACR
XPNPEP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10553-ANR
XPNPEP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10553-CF
XPNPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10553-NF
XPNPEP1 cDNA ORF Clone, Human, C-His tag HG10553-CH
XPNPEP1 cDNA ORF Clone, Human, N-His tag HG10553-NH
XPNPEP1 cDNA ORF Clone, Human, C-HA tag HG10553-CY
XPNPEP1 cDNA ORF Clone, Human, N-HA tag HG10553-NY
XPNPEP1 cDNA ORF Clone, Human, C-Myc tag HG10553-CM
XPNPEP1 cDNA ORF Clone, Human, N-Myc tag HG10553-NM
XPNPEP1 qPCR Primer Pairs, Human HP100566
info info
添加购物车成功! 添加购物车失败!