West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag

Cat: VG40345-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All WNV prM protein and Envelope Reagents

CRO Services

Product recommended


All WNV prM protein and Envelope Reagents

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag General Information

Gene

Species
WNV
NCBI Ref Seq
RefSeq ORF Size
2058 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 2.11kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WNV prM protein and Envelope cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5610

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag Alternative Names

WNV-prM and E cDNA ORF Clone, WNV

WNV prM protein and Envelope Background Information

WNV prM protein and Envelope cDNA ORF Clone, WNV, Related Products

Product Name Catalog#(PDF)
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid VG40345-G
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E natural ORF mammalian expression plasmid VG40345-UT
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-GFPSpark tag VG40345-ACG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40345-ACGLN
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-GFPSpark tag VG40345-ANG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40345-ACR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40345-ANR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-Flag tag VG40345-CF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-Flag tag VG40345-NF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-His tag VG40345-NH
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-HA tag VG40345-CY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-HA tag VG40345-NY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-Myc tag VG40345-CM
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-Myc tag VG40345-NM
info info
添加购物车成功! 添加购物车失败!