VEGFD cDNA ORF Clone, Human, C-DDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

VEGFD cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human c-fos induced growth factor (vascular endothelial growth factor D) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 1.12kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VEGFD cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VEGFD cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

VEGF-D cDNA ORF Clone, Human; VEGFD cDNA ORF Clone, Human

VEGFD Background Information

Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.
Full Name
c-fos induced growth factor (vascular endothelial growth factor D)
References
  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait