VRK1 cDNA ORF Clone, Rat, C-His tag

Cat: RG81611-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VRK1 Reagents
CRO Services
Product recommended

All VRK1 Reagents
VRK1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Rat vaccinia related kinase 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VRK1 Background Information

VRK1 is a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. Serine/threonine protein kinases are tumor suppressor that controls the activity of AMP-activated protein kinase family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. VRK1 contains 1 protein kinase domain and localizes to the nucleus. VRK1 gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. As a serine/threonine kinase, VRK1 phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Defects in VRK1 are the cause of pontocerebellar hypoplasia type 1 (PCH1), also called pontocerebellar hypoplasia with infantile spinal muscular atrophy or pontocerebellar hypoplasia with anterior horn cell disease. PCH1 is characterized by an abnormally small cerebellum and brainstem, central and peripheral motor dysfunction from birth, gliosis and anterior horn cell degeneration resembling infantile spinal muscular atrophy.

Full Name
vaccinia related kinase 1
References
  • Sugimoto J, et al. (1999) Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus. J Hum Genet. 44 (2): 133-4.
  • Lopez-Borges S, et al. (2000) The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Oncogene. 19 (32): 3656-64.
  • Sevilla A, et al. (2004) c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Oncogene. 23 (55): 8950-8.
  • VRK1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VRK1 cDNA ORF Clone in Cloning Vector, Rat RG81611-G
    VRK1 cDNA ORF Clone, Rat, untagged RG81611-UT
    VRK1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81611-ACGLN
    VRK1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81611-ACG
    VRK1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81611-ANG
    VRK1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81611-ACR
    VRK1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81611-ANR
    VRK1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81611-CF
    VRK1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81611-NF
    VRK1 cDNA ORF Clone, Rat, N-His tag RG81611-NH
    VRK1 cDNA ORF Clone, Rat, C-HA tag RG81611-CY
    VRK1 cDNA ORF Clone, Rat, N-HA tag RG81611-NY
    VRK1 cDNA ORF Clone, Rat, C-Myc tag RG81611-CM
    VRK1 cDNA ORF Clone, Rat, N-Myc tag RG81611-NM

    VRK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VRK1 cDNA ORF Clone in Cloning Vector, Human HG11555-M
    VRK1 cDNA ORF Clone, Human, untagged HG11555-UT
    VRK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11555-ACG
    VRK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11555-ACGLN
    VRK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11555-ANG
    VRK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11555-ACR
    VRK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11555-ANR
    VRK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11555-CF
    VRK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11555-NF
    VRK1 cDNA ORF Clone, Human, C-His tag HG11555-CH
    VRK1 cDNA ORF Clone, Human, N-His tag HG11555-NH
    VRK1 cDNA ORF Clone, Human, C-HA tag HG11555-CY
    VRK1 cDNA ORF Clone, Human, N-HA tag HG11555-NY
    VRK1 cDNA ORF Clone, Human, C-Myc tag HG11555-CM
    VRK1 cDNA ORF Clone, Human, N-Myc tag HG11555-NM
    VRK1 qPCR Primer Pairs, Human HP101661
    info info
    添加购物车成功! 添加购物车失败!