After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte SerpinA11 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat SERPINA11 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001166352.1
cDNA-Größe:1269bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11.
Synonyme für Gene:Serpina11
Spezies:Rat
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified. Mouse Serpin A11, also known as SERPINA11, is a member of the serpin family.

Referenzen
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Size / Price
    Katalog: RG81027-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“