RSU1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80855-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RSU1 Reagents

CRO Services

Product recommended


All RSU1 Reagents

RSU1 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Rat Ras suppressor protein 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSU1 Background Information

Full Name
Ras suppressor protein 1

RSU1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Ferret FG60090-G
RSU1 cDNA ORF Clone, Ferret, untagged FG60090-UT
RSU1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60090-ACG
RSU1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60090-ACGLN
RSU1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60090-ANG
RSU1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60090-ACR
RSU1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60090-ANR
RSU1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60090-CF
RSU1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60090-NF
RSU1 cDNA ORF Clone, Ferret, C-His tag FG60090-CH
RSU1 cDNA ORF Clone, Ferret, N-His tag FG60090-NH
RSU1 cDNA ORF Clone, Ferret, C-HA tag FG60090-CY
RSU1 cDNA ORF Clone, Ferret, N-HA tag FG60090-NY
RSU1 cDNA ORF Clone, Ferret, C-Myc tag FG60090-CM
RSU1 cDNA ORF Clone, Ferret, N-Myc tag FG60090-NM

RSU1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Rat RG80855-U
RSU1 cDNA ORF Clone, Rat, untagged RG80855-UT
RSU1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80855-ACG
RSU1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80855-ACGLN
RSU1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80855-ANG
RSU1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80855-ACR
RSU1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80855-ANR
RSU1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80855-CF
RSU1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80855-NF
RSU1 cDNA ORF Clone, Rat, C-His tag RG80855-CH
RSU1 cDNA ORF Clone, Rat, N-His tag RG80855-NH
RSU1 cDNA ORF Clone, Rat, C-HA tag RG80855-CY
RSU1 cDNA ORF Clone, Rat, N-HA tag RG80855-NY
RSU1 cDNA ORF Clone, Rat, N-Myc tag RG80855-NM
RSU1 qPCR Primer Pairs, Rat RP300819

RSU1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Mouse MG53805-U
RSU1 cDNA ORF Clone, Mouse, untagged MG53805-UT
RSU1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53805-ACG
RSU1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53805-ACGLN
RSU1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53805-ANG
RSU1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53805-ACR
RSU1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53805-ANR
RSU1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53805-CF
RSU1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53805-NF
RSU1 cDNA ORF Clone, Mouse, C-His tag MG53805-CH
RSU1 cDNA ORF Clone, Mouse, N-His tag MG53805-NH
RSU1 cDNA ORF Clone, Mouse, C-HA tag MG53805-CY
RSU1 cDNA ORF Clone, Mouse, N-HA tag MG53805-NY
RSU1 cDNA ORF Clone, Mouse, C-Myc tag MG53805-CM
RSU1 cDNA ORF Clone, Mouse, N-Myc tag MG53805-NM

RSU1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Human HG16900-U
RSU1 cDNA ORF Clone, Human, untagged HG16900-UT
RSU1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16900-ACG
RSU1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16900-ACGLN
RSU1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16900-ANG
RSU1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16900-ACR
RSU1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16900-ANR
RSU1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16900-CF
RSU1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16900-NF
RSU1 cDNA ORF Clone, Human, C-His tag HG16900-CH
RSU1 cDNA ORF Clone, Human, N-His tag HG16900-NH
RSU1 cDNA ORF Clone, Human, C-HA tag HG16900-CY
RSU1 cDNA ORF Clone, Human, N-HA tag HG16900-NY
RSU1 cDNA ORF Clone, Human, C-Myc tag HG16900-CM
RSU1 cDNA ORF Clone, Human, N-Myc tag HG16900-NM
info info
添加购物车成功! 添加购物车失败!