Schnelle Bestellung

Ratte CD112/Nectin-2/PVRL2 Gene ORF cDNA clone expression plasmid, N-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Ratte PVRL2 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001012064.1
    cDNA-Größe:1593bp
    cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus poliovirus receptor-related 2 with N terminal His tag.
    Synonyme für Gene:MGC94554, Pvrl2
    Spezies:Rat
    Vektor:pCMV3-SP-N-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PVRL2 qPCR primers for gene expression analysis, RP300298 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Hintergrund

    Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

    Referenzen
  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
  • Size / Price
    Katalog: RG80327-NH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“