After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte PROM1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat PROM1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001110137.1
cDNA-Größe:2481bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus prominin 1 with C terminal HA tag.
Synonyme für Gene:Prom, CD133, MGC156650, Prom1
Spezies:Rat
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Hintergrund

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

Referenzen
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    Katalog: RG80324-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“