Schnelle Bestellung

Ratte PPP2R1A Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Ratte PPP2R1A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_057140.1
cDNA-Größe:1770bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus protein phosphatase 2, regulatory subunit A, alpha.
Synonyme für Gene:PR65
Spezies:Rat
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PPP2R1A qPCR primers for gene expression analysis, RP300979 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: RG81015-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“