After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat NUDT5 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001007733.1
cDNA-Größe:660bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Myc tag.
Synonyme für Gene:Nudt5
Spezies:Rat
Vektor:pCMV3-C-Myc
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratte ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Product nameProduct name
Hintergrund

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Referenzen
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Katalog: RG81109-CM
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“