After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat NUDT5 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001007733.1
cDNA-Größe:660bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.
Synonyme für Gene:Nudt5
Spezies:Rat
Vektor:pCMV3-C-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratte ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Product nameProduct name
Hintergrund

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Referenzen
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Katalog: RG81109-CF
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“