After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratte CD73/NT5E Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat NT5E Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_021576.2
cDNA-Größe:1731bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus 5' nucleotidase, ecto with N terminal His tag.
Synonyme für Gene:Nt5, CD73, MGC112615, Nt5e
Spezies:Rat
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

Referenzen
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Katalog: RG80335-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“