Schnelle Bestellung

Ratte CD61/Integrin beta 3/ITGB3 Gene ORF cDNA clone expression plasmid, C-His tag

  • Rat CD61/Integrin beta 3/ITGB3 Gene Plasmid Map 17379
DatenblattBewertungenÄhnliche ProdukteProtokolle
Ratte ITGB3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_153720.1
cDNA-Größe:2409 bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with C terminal His tag.
Synonyme für Gene:Itgb3
Spezies:Rat
Vektor:pCMV3-C-His
Plasmid:pCMV3-ratITGB3-His
Restriktionsschnittstelle:KpnI(two restriction sites) + XbaI(6kb+1.94kb+0.48)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB3 qPCR primers for gene expression analysis, RP300285 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: RG80312-CH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“