After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratte IL-11 / interleukin 11 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat IL11 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_133519.3
cDNA-Größe:600bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus interleukin 11 with N terminal Flag tag.
Synonyme für Gene:Il11
Spezies:Rat
Vektor:pCMV3-SP-N-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Hintergrund

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

Referenzen
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • Size / Price
    Katalog: RG80169-NF
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“