After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Rat HepaCAM2 natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat HEPACAM2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001106580.2
cDNA-Größe:1392bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus HEPACAM family member 2.
Synonyme für Gene:RGD1305697, Hepacam2
Spezies:Rat
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

HepaCAM2 belongs to the immunoglobulin family. HepaCAM2, together with HEPACAM1, are cell adhesion molecules. HEPACAM1 modulates cell adhesion and migration. It also inhibits cancer cell growth. HepaCAM2 contains 2 Ig-like C2-type (immunoglobulin-like) domains. The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions.

Referenzen
  • Moh MC, et al. (2008) Expression of hepaCAM is downregulated in cancers and induces senescence-like growth arrest via a p53/p21-dependent pathway in human breast cancer cells. Carcinogenesis. 29(12):2298-305.
  • Moh MC, et al. (2005) Structural and functional analyses of a novel ig-like cell adhesion molecule, hepaCAM, in the human breast carcinoma MCF7 cells. J Biol Chem. 280(29):27366-74.
  • Chung Moh M, et al. (2005) Cloning and characterization of hepaCAM, a novel Ig-like cell adhesion molecule suppressed in human hepatocellular carcinoma. J Hepatol. 42(6):833-41.
  • Size / Price
    Katalog: RG80242-UT
    Listenpreis:   (Save )
    Preis:      [How to order]
    Verfügbarkeit2-3 weeksAnweisungen für die Lieferung
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“