GOT2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG81148-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GOT2 Reagents

CRO Services

Product recommended


All GOT2 Reagents

GOT2 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Rat glutamic-oxaloacetic transaminase 2, mitochondrial with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GOT2 Background Information

GOT2 is a mitochondrial enzyme that oxidizes glutamate to produce alpha-ketoglutarate for the Krebs cycle, eventually leading to the production of adenosine triphosphate (ATP). GOT2-mediated ATP synthesis may be a pivotal mechanism underlying the protective effect of febuxostat against neurodegeneration in experimental autoimmune encephalomyelitis (EAE). The high aberrant GOT2 expression is prognostic in diffuse large B-cell lymphoma underscoring the current findings
Full Name
glutamic-oxaloacetic transaminase 2, mitochondrial

GOT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Rat RG81148-U
GOT2 cDNA ORF Clone, Rat, untagged RG81148-UT
GOT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81148-ACGLN
GOT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81148-ACG
GOT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81148-ACR
GOT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81148-CF
GOT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81148-NF
GOT2 cDNA ORF Clone, Rat, C-His tag RG81148-CH
GOT2 cDNA ORF Clone, Rat, N-His tag RG81148-NH
GOT2 cDNA ORF Clone, Rat, C-HA tag RG81148-CY
GOT2 cDNA ORF Clone, Rat, C-Myc tag RG81148-CM
GOT2 cDNA ORF Clone, Rat, N-Myc tag RG81148-NM
GOT2 qPCR Primer Pairs, Rat RP301104

GOT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Mouse MG51279-G
GOT2 cDNA ORF Clone, Mouse, untagged MG51279-UT
GOT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51279-ACG
GOT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51279-ACGLN
GOT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51279-ANG
GOT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51279-ACR
GOT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51279-ANR
GOT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51279-CF
GOT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51279-NF
GOT2 cDNA ORF Clone, Mouse, C-His tag MG51279-CH
GOT2 cDNA ORF Clone, Mouse, N-His tag MG51279-NH
GOT2 cDNA ORF Clone, Mouse, C-HA tag MG51279-CY
GOT2 cDNA ORF Clone, Mouse, N-HA tag MG51279-NY
GOT2 cDNA ORF Clone, Mouse, C-Myc tag MG51279-CM
GOT2 cDNA ORF Clone, Mouse, N-Myc tag MG51279-NM
GOT2 qPCR Primer Pairs, Mouse MP201161

GOT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Human HG14463-G
GOT2 cDNA ORF Clone, Human, untagged HG14463-UT
GOT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14463-ACGLN
GOT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14463-ACG
GOT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14463-ANG
GOT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14463-ACR
GOT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14463-ANR
GOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14463-CF
GOT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14463-NF
GOT2 cDNA ORF Clone, Human, C-His tag HG14463-CH
GOT2 cDNA ORF Clone, Human, N-His tag HG14463-NH
GOT2 cDNA ORF Clone, Human, C-HA tag HG14463-CY
GOT2 cDNA ORF Clone, Human, N-HA tag HG14463-NY
GOT2 cDNA ORF Clone, Human, C-Myc tag HG14463-CM
GOT2 cDNA ORF Clone, Human, N-Myc tag HG14463-NM
GOT2 qPCR Primer Pairs, Human HP103111
info info
添加购物车成功! 添加购物车失败!