FAM118B cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

FAM118B cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Rat family with sequence similarity 118, member B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM118B Background Information

Full Name
family with sequence similarity 118, member B

FAM118B cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed