EGFL8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81325-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EGFL8 Reagents

CRO Services

Product recommended


All EGFL8 Reagents

EGFL8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
858 bp
Description
Full length Clone DNA of Rat EGF-like-domain, multiple 8 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFL8 Background Information

Full Name
EGF-like-domain, multiple 8

EGFL8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EGFL8 cDNA ORF Clone in Cloning Vector, Rat RG81325-G
EGFL8 cDNA ORF Clone, Rat, untagged RG81325-UT
EGFL8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81325-ACG
EGFL8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81325-ACGLN
EGFL8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81325-ACR
EGFL8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81325-CF
EGFL8 cDNA ORF Clone, Rat, C-His tag RG81325-CH
EGFL8 cDNA ORF Clone, Rat, N-His tag RG81325-NH
EGFL8 cDNA ORF Clone, Rat, C-HA tag RG81325-CY
EGFL8 cDNA ORF Clone, Rat, N-HA tag RG81325-NY
EGFL8 cDNA ORF Clone, Rat, C-Myc tag RG81325-CM
EGFL8 cDNA ORF Clone, Rat, N-Myc tag RG81325-NM
EGFL8 qPCR Primer Pairs, Rat RP301296

EGFL8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EGFL8 cDNA ORF Clone in Cloning Vector, Mouse MG53494-G
EGFL8 cDNA ORF Clone, Mouse, untagged MG53494-UT
EGFL8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53494-ACGLN
EGFL8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53494-ACG
EGFL8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53494-ACR
EGFL8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53494-CF
EGFL8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53494-NF
EGFL8 cDNA ORF Clone, Mouse, C-His tag MG53494-CH
EGFL8 cDNA ORF Clone, Mouse, N-His tag MG53494-NH
EGFL8 cDNA ORF Clone, Mouse, C-HA tag MG53494-CY
EGFL8 cDNA ORF Clone, Mouse, N-HA tag MG53494-NY
EGFL8 cDNA ORF Clone, Mouse, C-Myc tag MG53494-CM
EGFL8 cDNA ORF Clone, Mouse, N-Myc tag MG53494-NM

EGFL8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EGFL8 cDNA ORF Clone in Cloning Vector, Human HG13241-G
EGFL8 cDNA ORF Clone, Human, untagged HG13241-UT
EGFL8 cDNA ORF Clone, Human, C-GFPSpark® tag HG13241-ACG
EGFL8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13241-ACGLN
EGFL8 cDNA ORF Clone, Human, C-OFPSpark® tag HG13241-ACR
EGFL8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13241-CF
EGFL8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13241-NF
EGFL8 cDNA ORF Clone, Human, C-His tag HG13241-CH
EGFL8 cDNA ORF Clone, Human, N-His tag HG13241-NH
EGFL8 cDNA ORF Clone, Human, C-HA tag HG13241-CY
EGFL8 cDNA ORF Clone, Human, N-HA tag HG13241-NY
EGFL8 cDNA ORF Clone, Human, C-Myc tag HG13241-CM
EGFL8 cDNA ORF Clone, Human, N-Myc tag HG13241-NM
EGFL8 qPCR Primer Pairs, Human HP101952
info info
添加购物车成功! 添加购物车失败!