Schnelle Bestellung

Ratte Contactin 3/CNTN3 Gene ORF cDNA clone expression plasmid, N-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Ratte CNTN3 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_019329.1
    cDNA-Größe:3087bp
    cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus contactin 3 (plasmacytoma associated) with N terminal His tag.
    Synonyme für Gene:Pang, BIG-1, Cntn3
    Spezies:Rat
    Vektor:pCMV3-SP-N-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CNTN3 qPCR primers for gene expression analysis, RP300289 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Hintergrund

    Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

    Referenzen
  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Size / Price
    Katalog: RG80316-NH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“