Schnelle Bestellung

Ratte CLEC5A / MDL1 / MDL-1 Gene ORF cDNA clone expression plasmid

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Ratte CLEC5A Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001109377.1
    cDNA-Größe:573bp
    cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A.
    Synonyme für Gene:Clec5a
    Spezies:Rat
    Vektor:pCMV3-untagged
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC5A qPCR primers for gene expression analysis, RP300244 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Hintergrund

    CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

    Referenzen
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Katalog: RG80259-UT
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“