After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte CLEC4B2 / mDCAR1 Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat CLEC4B2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001005896.1
cDNA-Größe:627bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
Synonyme für Gene:Aplra1, Clec4b2
Spezies:Rat
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

Referenzen
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Katalog: RG80265-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“