CLEC2D cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

CLEC2D cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
702 bp
Description
Full length Clone DNA of Rat C-type lectin domain family 2, member D with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CLEC2D Background Information

Lectin-like transcript 1 (LLT1) encoded by CLEC2D gene is a C-type lectin-like molecule interacting with human CD161 (NKR-P1A) receptor expressed by natural killer cells and subsets of T cells. CLEC2D transcripts were detected primarily in hematopoietic cell lines and were found to be co-induced by the same activation signals. Although very low amounts of putative soluble CLEC2D protein isoforms could be produced by transfectants, CLEC2D isoforms 2 and 4 were efficiently expressed. CLEC2D uses gene splicing to generate protein isoforms that are structurally distinct and that have different biological activities. Prostate cancer is the most common type of cancer diagnosed and the second leading cause of cancer-related death in American men. Natural Killer (NK) cells are the first line of defense against cancer and infections. NK cell function is regulated by a delicate balance between signals received through activating and inhibitory receptors. Previously, we identified Lectin-like transcript-1 (LLT1/OCIL/CLEC2D) as a counter-receptor for the NK cell inhibitory receptor NKRP1A (CD161). Interaction of LLT1 expressed on target cells with NKRP1A inhibits NK cell activation.
Full Name
C-type lectin domain family 2, member D
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后