CCRK cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81634-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CCRK Reagents

CRO Services

Product recommended


All CCRK Reagents

CCRK cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat cyclin-dependent kinase 20 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCRK Background Information

Full Name
cyclin-dependent kinase 20

CCRK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCRK cDNA ORF Clone in Cloning Vector, Rat RG81634-G
CCRK cDNA ORF Clone, Rat, untagged RG81634-UT
CCRK cDNA ORF Clone, Rat, C-GFPSpark® tag RG81634-ACG
CCRK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81634-ACGLN
CCRK cDNA ORF Clone, Rat, C-OFPSpark® tag RG81634-ACR
CCRK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81634-CF
CCRK cDNA ORF Clone, Rat, C-His tag RG81634-CH
CCRK cDNA ORF Clone, Rat, N-His tag RG81634-NH
CCRK cDNA ORF Clone, Rat, C-HA tag RG81634-CY
CCRK cDNA ORF Clone, Rat, N-HA tag RG81634-NY
CCRK cDNA ORF Clone, Rat, C-Myc tag RG81634-CM
CCRK cDNA ORF Clone, Rat, N-Myc tag RG81634-NM

CCRK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCRK cDNA ORF Clone in Cloning Vector, Human HG12199-G
CCRK cDNA ORF Clone, Human, untagged HG12199-UT
CCRK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12199-ACGLN
CCRK cDNA ORF Clone, Human, C-GFPSpark® tag HG12199-ACG
CCRK cDNA ORF Clone, Human, N-GFPSpark® tag HG12199-ANG
CCRK cDNA ORF Clone, Human, C-OFPSpark® tag HG12199-ACR
CCRK cDNA ORF Clone, Human, N-OFPSpark® tag HG12199-ANR
CCRK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12199-CF
CCRK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12199-NF
CCRK cDNA ORF Clone, Human, C-His tag HG12199-CH
CCRK cDNA ORF Clone, Human, N-His tag HG12199-NH
CCRK cDNA ORF Clone, Human, C-HA tag HG12199-CY
CCRK cDNA ORF Clone, Human, N-HA tag HG12199-NY
CCRK cDNA ORF Clone, Human, C-Myc tag HG12199-CM
CCRK cDNA ORF Clone, Human, N-Myc tag HG12199-NM
CCRK qPCR Primer Pairs, Human HP101826
info info
添加购物车成功! 添加购物车失败!