After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Ratte Cadherin-17/LI-cadherin Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat CDH17 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_053977.2
cDNA-Größe:2484bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus cadherin 17 with C terminal His tag.
Synonyme für Gene:Cdh17
Spezies:Rat
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.

Referenzen
  • Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.
  • Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.
  • Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.
  • Size / Price
    Katalog: RG80283-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“