Schnelle Bestellung

Ratte CD68 Gene ORF cDNA clone expression plasmid, N-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Ratte CD68 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001031638.1
    cDNA-Größe:993bp
    cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus Cd68 molecule with N terminal His tag.
    Synonyme für Gene:MGC114377, Cd68
    Spezies:Rat
    Vektor:pCMV3-SP-N-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD68 qPCR primers for gene expression analysis, RP300283 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Hintergrund

    Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

    Referenzen
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Katalog: RG80307-NH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“