After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratte CCL6/C10 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Rat CCL6 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC079460.1
cDNA-Größe:348bp
cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 6 with N terminal Myc tag.
Synonyme für Gene:Mrp-1, Scay6
Spezies:Rat
Vektor:pCMV3-SP-N-Myc
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Hintergrund

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

Referenzen
  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.
  •  

    CCL6/C10 related areas, pathways, and other information

    Size / Price
    Katalog: RG80721-NM
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“