BMP7 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80120-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BMP7 Reagents

CRO Services

Product recommended


All BMP7 Reagents

BMP7 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Rat bone morphogenetic protein 7 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP7 Background Information

BMP-7 (Bone morphogenetic protein 7), also known as osteogenic protein 1 (OP-1), is a bone morphogenetic protein which belongs to the TGF-β superfamily. OP-1 is expressed in the brain, kidneys and bladder. BMP-7 may be involved in bone homeostasis. Osteogenic protein 1 plays a key role in the transformation of mesenchymal cells into bone and cartilage. The phosphorylation of SMAD1 and SMAD5 can be induced by BMP-7, which in turn induce transcription of numerous osteogenic genes. BMP-7 treatment can also induce all of the genetic markers of osteoblast differentiation in many cell types. The expression of BMP-7 causes ventral phenotypes while its complete inhibition creates a dorsal phenotype. Human recombinant BMP-7 protein can be used to aid in the fusion of vertebral bodies to prevent neurologic trauma. It also functions in the treatment of tibial non-union, frequently in cases where a bone graft has failed. It is found that BMP7 has the potential for treatment of chronic kidney disease.
Full Name
bone morphogenetic protein 7
References
  • Shi J. et al., 2010, Fertil Steril. 93(4): 1273-9.
  • González EA. et al., 2002, Kidney Int. 61(4): 1322-31.
  • Gould SE. et al., 2002, Kidney Int. 61(1): 51-60.
  • Hahn GV. et al., 1992, Genomics. 14(3): 759-62.
  • BMP7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BMP7 cDNA ORF Clone in Cloning Vector, Rat RG80120-G
    BMP7 cDNA ORF Clone, Rat, untagged RG80120-UT
    BMP7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80120-ACGLN
    BMP7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80120-ACG
    BMP7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80120-ACR
    BMP7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80120-CF
    BMP7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80120-NF
    BMP7 cDNA ORF Clone, Rat, C-His tag RG80120-CH
    BMP7 cDNA ORF Clone, Rat, N-His tag RG80120-NH
    BMP7 cDNA ORF Clone, Rat, C-HA tag RG80120-CY
    BMP7 cDNA ORF Clone, Rat, N-HA tag RG80120-NY
    BMP7 cDNA ORF Clone, Rat, C-Myc tag RG80120-CM
    BMP7 qPCR Primer Pairs, Rat RP300115

    BMP7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMP7 cDNA ORF Clone in Cloning Vector, Human HG10083-M
    BMP7 cDNA ORF Clone, Human, untagged HG10083-UT
    BMP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10083-ACGLN
    BMP7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10083-ACG
    BMP7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10083-ACR
    BMP7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10083-CF
    BMP7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10083-NF
    BMP7 cDNA ORF Clone, Human, C-His tag HG10083-CH
    BMP7 cDNA ORF Clone, Human, N-His tag HG10083-NH
    BMP7 cDNA ORF Clone, Human, C-HA tag HG10083-CY
    BMP7 cDNA ORF Clone, Human, N-HA tag HG10083-NY
    BMP7 cDNA ORF Clone, Human, C-Myc tag HG10083-CM
    BMP7 cDNA ORF Clone, Human, N-Myc tag HG10083-NM
    BMP7 qPCR Primer Pairs, Human HP100169

    BMP7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMP7 qPCR Primer Pairs, Mouse MP200659
    info info
    添加购物车成功! 添加购物车失败!