Schnelle Bestellung

Ratte ADH5 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Ratte ADH5 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001126120.1
    cDNA-Größe:1125bp
    cDNA-Beschreibung:Full length Clone DNA of Rattus norvegicus alcohol dehydrogenase 5 (class III), chi polypeptide with C terminal Myc tag.
    Synonyme für Gene:Adh5
    Spezies:Rat
    Vektor:pCMV3-C-Myc
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ADH5 qPCR primers for gene expression analysis, RP301081 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Hintergrund

    Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

    Referenzen
  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • Size / Price
    Katalog: RG81124-CM
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“