ACADM/MCAD cDNA ORF Clone, Rat, N-HA tag

Cat: RG81147-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ACADM/MCAD Reagents

CRO Services

Product recommended


All ACADM/MCAD Reagents

ACADM/MCAD cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1266 bp
Description
Full length Clone DNA of Rat acyl-CoA dehydrogenase, C-4 to C-12 straight chain with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADM/MCAD Background Information

Full Name
acyl-CoA dehydrogenase, C-4 to C-12 straight chain

ACADM/MCAD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Rat RG81147-U
ACADM/MCAD cDNA ORF Clone, Rat, untagged RG81147-UT
ACADM/MCAD cDNA ORF Clone, Rat, C-GFPSpark® tag RG81147-ACG
ACADM/MCAD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81147-ACGLN
ACADM/MCAD cDNA ORF Clone, Rat, N-GFPSpark® tag RG81147-ANG
ACADM/MCAD cDNA ORF Clone, Rat, C-OFPSpark® tag RG81147-ACR
ACADM/MCAD cDNA ORF Clone, Rat, N-OFPSpark® tag RG81147-ANR
ACADM/MCAD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81147-CF
ACADM/MCAD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81147-NF
ACADM/MCAD cDNA ORF Clone, Rat, C-His tag RG81147-CH
ACADM/MCAD cDNA ORF Clone, Rat, N-His tag RG81147-NH
ACADM/MCAD cDNA ORF Clone, Rat, C-HA tag RG81147-CY
ACADM/MCAD cDNA ORF Clone, Rat, C-Myc tag RG81147-CM
ACADM/MCAD cDNA ORF Clone, Rat, N-Myc tag RG81147-NM
ACADM/MCAD qPCR Primer Pairs, Rat RP301103

ACADM/MCAD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Mouse MG51216-G
ACADM/MCAD cDNA ORF Clone, Mouse, untagged MG51216-UT
ACADM/MCAD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51216-ACG
ACADM/MCAD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51216-ACGLN
ACADM/MCAD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51216-ANG
ACADM/MCAD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51216-ACR
ACADM/MCAD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51216-ANR
ACADM/MCAD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51216-CF
ACADM/MCAD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51216-NF
ACADM/MCAD cDNA ORF Clone, Mouse, C-His tag MG51216-CH
ACADM/MCAD cDNA ORF Clone, Mouse, N-His tag MG51216-NH
ACADM/MCAD cDNA ORF Clone, Mouse, C-HA tag MG51216-CY
ACADM/MCAD cDNA ORF Clone, Mouse, N-HA tag MG51216-NY
ACADM/MCAD cDNA ORF Clone, Mouse, C-Myc tag MG51216-CM
ACADM/MCAD cDNA ORF Clone, Mouse, N-Myc tag MG51216-NM
ACADM/MCAD qPCR Primer Pairs, Mouse MP201100

ACADM/MCAD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Human HG14896-G
ACADM/MCAD cDNA ORF Clone, Human, untagged HG14896-UT
ACADM/MCAD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14896-ACGLN
ACADM/MCAD cDNA ORF Clone, Human, C-GFPSpark® tag HG14896-ACG
ACADM/MCAD cDNA ORF Clone, Human, N-GFPSpark® tag HG14896-ANG
ACADM/MCAD cDNA ORF Clone, Human, C-OFPSpark® tag HG14896-ACR
ACADM/MCAD cDNA ORF Clone, Human, N-OFPSpark® tag HG14896-ANR
ACADM/MCAD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14896-CF
ACADM/MCAD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14896-NF
ACADM/MCAD cDNA ORF Clone, Human, C-His tag HG14896-CH
ACADM/MCAD cDNA ORF Clone, Human, N-His tag HG14896-NH
ACADM/MCAD cDNA ORF Clone, Human, C-HA tag HG14896-CY
ACADM/MCAD cDNA ORF Clone, Human, N-HA tag HG14896-NY
ACADM/MCAD cDNA ORF Clone, Human, C-Myc tag HG14896-CM
ACADM/MCAD cDNA ORF Clone, Human, N-Myc tag HG14896-NM
ACADM/MCAD qPCR Primer Pairs, Human HP103525
info info
添加购物车成功! 添加购物车失败!