Schnelle Bestellung

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PRKAA1 Produktinformation zum cDNA-Klon
Synonyme für Gene:
Human PRKAA1 Gene Plasmid Map
Human PRKAA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
  • Human PRKAA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.