After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PLA2G2D Produktinformation zum cDNA-Klon
Synonyme für Gene:
Human PLA2G2D Gene Plasmid Map
Human PLA2G2D Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Human PLA2G2D Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Kürzlich angesehene Artikel
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.