Ku70 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51883-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Ku70 Reagents

CRO Services

Product recommended


All Ku70 Reagents

Ku70 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1827 bp
Description
Full length Clone DNA of Mouse X-ray repair complementing defective repair in Chinese hamster cells 6 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ku70 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

70kDa cDNA ORF Clone, Mouse;G22p1 cDNA ORF Clone, Mouse;Ku70 cDNA ORF Clone, Mouse

Ku70 Background Information

XRCC6 (X-ray repair complementing defective repair in Chinese hamster cells 6) is involved in tumor growth in several tumor types.XRCC6 exerts tumor-promoting effects for OS through β-catenin/Wnt signaling pathway. In addition, XRCC6 and XRCC7 are two DNA repair genes forme an integral part of double strand break repair (DSBR) pathway.
Full Name
X-ray repair complementing defective repair in Chinese hamster cells 6

Ku70 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Ku70 cDNA ORF Clone in Cloning Vector, Mouse MG51883-G
Ku70 cDNA ORF Clone, Mouse, untagged MG51883-UT
Ku70 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51883-ACGLN
Ku70 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51883-ACG
Ku70 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51883-ANG
Ku70 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51883-ACR
Ku70 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51883-ANR
Ku70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51883-CF
Ku70 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51883-NF
Ku70 cDNA ORF Clone, Mouse, C-His tag MG51883-CH
Ku70 cDNA ORF Clone, Mouse, N-His tag MG51883-NH
Ku70 cDNA ORF Clone, Mouse, C-HA tag MG51883-CY
Ku70 cDNA ORF Clone, Mouse, N-HA tag MG51883-NY
Ku70 cDNA ORF Clone, Mouse, C-Myc tag MG51883-CM
Ku70 qPCR Primer Pairs, Mouse MP201756

Ku70 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Ku70 cDNA ORF Clone in Cloning Vector, Human HG12176-G
Ku70 cDNA ORF Clone, Human, untagged HG12176-UT
Ku70 cDNA ORF Clone, Human, C-GFPSpark® tag HG12176-ACG
Ku70 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12176-ACGLN
Ku70 cDNA ORF Clone, Human, N-GFPSpark® tag HG12176-ANG
Ku70 cDNA ORF Clone, Human, C-OFPSpark® tag HG12176-ACR
Ku70 cDNA ORF Clone, Human, N-OFPSpark® tag HG12176-ANR
Ku70 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12176-CF
Ku70 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12176-NF
Ku70 cDNA ORF Clone, Human, C-His tag HG12176-CH
Ku70 cDNA ORF Clone, Human, N-His tag HG12176-NH
Ku70 cDNA ORF Clone, Human, C-HA tag HG12176-CY
Ku70 cDNA ORF Clone, Human, N-HA tag HG12176-NY
Ku70 cDNA ORF Clone, Human, C-Myc tag HG12176-CM
Ku70 cDNA ORF Clone, Human, N-Myc tag HG12176-NM
Ku70 qPCR Primer Pairs, Human HP101834
info info
添加购物车成功! 添加购物车失败!