WBP11 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51456-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WBP11 Reagents
CRO Services
Product recommended

All WBP11 Reagents
WBP11 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1926 bp
Description
Full length Clone DNA of Mouse WW domain binding protein 11 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WBP11 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2510026P17Rik cDNA ORF Clone, Mouse;D6Wsu113e cDNA ORF Clone, Mouse;Npwbp cDNA ORF Clone, Mouse;SIPP1 cDNA ORF Clone, Mouse
WBP11 Background Information
Full Name
WW domain binding protein 11

WBP11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WBP11 cDNA ORF Clone in Cloning Vector, Mouse MG51456-G
WBP11 cDNA ORF Clone, Mouse, untagged MG51456-UT
WBP11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51456-ACGLN
WBP11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51456-ACG
WBP11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51456-ANG
WBP11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51456-ACR
WBP11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51456-ANR
WBP11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51456-CF
WBP11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51456-NF
WBP11 cDNA ORF Clone, Mouse, C-His tag MG51456-CH
WBP11 cDNA ORF Clone, Mouse, N-His tag MG51456-NH
WBP11 cDNA ORF Clone, Mouse, C-HA tag MG51456-CY
WBP11 cDNA ORF Clone, Mouse, C-Myc tag MG51456-CM
WBP11 cDNA ORF Clone, Mouse, N-Myc tag MG51456-NM
WBP11 qPCR Primer Pairs, Mouse MP201340

WBP11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WBP11 cDNA ORF Clone in Cloning Vector, Human HG22200-U
WBP11 cDNA ORF Clone, Human, untagged HG22200-UT
WBP11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22200-ACGLN
WBP11 cDNA ORF Clone, Human, C-GFPSpark® tag HG22200-ACG
WBP11 cDNA ORF Clone, Human, N-GFPSpark® tag HG22200-ANG
WBP11 cDNA ORF Clone, Human, C-OFPSpark® tag HG22200-ACR
WBP11 cDNA ORF Clone, Human, N-OFPSpark® tag HG22200-ANR
WBP11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22200-CF
WBP11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22200-NF
WBP11 cDNA ORF Clone, Human, C-His tag HG22200-CH
WBP11 cDNA ORF Clone, Human, N-His tag HG22200-NH
WBP11 cDNA ORF Clone, Human, C-HA tag HG22200-CY
WBP11 cDNA ORF Clone, Human, N-HA tag HG22200-NY
WBP11 cDNA ORF Clone, Human, C-Myc tag HG22200-CM
WBP11 cDNA ORF Clone, Human, N-Myc tag HG22200-NM
info info
添加购物车成功! 添加购物车失败!