After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus USP5 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse USP5 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:AK154008.1
cDNA-Größe:2508bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus ubiquitin specific peptidase 5 (isopeptidase T).
Synonyme für Gene:ISOT, Ucht, ISOT-1, AA407472
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.

Referenzen
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Katalog: MG51371-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“