TIGIT cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50939-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All TIGIT Reagents

CRO Services

Product recommended


All TIGIT Reagents

TIGIT cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
735 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse T cell immunoreceptor with Ig and ITIM domains with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+0.74kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TIGIT cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIGIT cDNA ORF Clone, Mouse, N-Myc tag Validated Images

Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630

TIGIT cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

ENSMUSG00000071552 cDNA ORF Clone, Mouse;Vstm3 cDNA ORF Clone, Mouse

TIGIT Background Information

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
T cell immunoreceptor with Ig and ITIM domains
References
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat. Genet. 36:40-45.
  • Bechtel S., et al., (2007), The full-ORF clone resource of the German cDNA consortium.BMC Genomics 8:399-399.
  • Yu X., Harden K., et al.,(2009), The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat. Immunol. 10:48-57.
  • TIGIT cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TIGIT cDNA ORF Clone, Rhesus, untagged CG90890-UT
    TIGIT cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90890-ACG

    TIGIT cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    TIGIT cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90892-ACG

    TIGIT cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TIGIT cDNA ORF Clone, Rat, untagged RG8A6318-UT
    TIGIT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6318-ACGLN

    TIGIT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TIGIT cDNA ORF Clone in Cloning Vector, Mouse MG50939-G
    TIGIT cDNA ORF Clone, Mouse, untagged MG50939-UT
    TIGIT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50939-ACGLN
    TIGIT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50939-ACG
    TIGIT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50939-ACR
    TIGIT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50939-CF
    TIGIT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50939-NF
    TIGIT cDNA ORF Clone, Mouse, C-His tag MG50939-CH
    TIGIT cDNA ORF Clone, Mouse, N-His tag MG50939-NH
    TIGIT cDNA ORF Clone, Mouse, C-HA tag MG50939-CY
    TIGIT cDNA ORF Clone, Mouse, N-HA tag MG50939-NY
    TIGIT cDNA ORF Clone, Mouse, C-Myc tag MG50939-CM
    TIGIT qPCR Primer Pairs, Mouse MP200908

    TIGIT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TIGIT cDNA ORF Clone in Cloning Vector, Human HG10917-M
    TIGIT cDNA ORF Clone, Human, untagged HG10917-UT
    TIGIT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10917-ACGLN
    TIGIT cDNA ORF Clone, Human, C-GFPSpark® tag HG10917-ACG
    TIGIT cDNA ORF Clone, Human, C-OFPSpark® tag HG10917-ACR
    TIGIT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10917-CF
    TIGIT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10917-NF
    TIGIT cDNA ORF Clone, Human, C-His tag HG10917-CH
    TIGIT cDNA ORF Clone, Human, N-His tag HG10917-NH
    TIGIT cDNA ORF Clone, Human, C-HA tag HG10917-CY
    TIGIT cDNA ORF Clone, Human, N-HA tag HG10917-NY
    TIGIT cDNA ORF Clone, Human, C-Myc tag HG10917-CM
    TIGIT cDNA ORF Clone, Human, N-Myc tag HG10917-NM
    TIGIT qPCR Primer Pairs, Human HP100800
    info info
    添加购物车成功! 添加购物车失败!