TFPI2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51002-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TFPI2 Reagents
CRO Services
Product recommended

All TFPI2 Reagents
TFPI2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
693 bp
Description
Full length Clone DNA of Mouse tissue factor pathway inhibitor 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TFPI2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AV000670 cDNA ORF Clone, Mouse;PP5/TFPI-2 cDNA ORF Clone, Mouse
TFPI2 Background Information

Tissue factor pathway inhibitor-2 (TFPI2), a member of the Kunitz-type serine proteinase inhibitor family, is a structural homologue of tissue factor pathway inhibitor (TFPI). It is a 32 kDa matrix-associated glycoprotein consisting of a short amino-terminal region, three tandem Kunitz-type domains and a positively charged carboxy-terminal tail. TFPI2 inhibits plasmin-dependent activation of several metalloproteinases. TFPI2 is highly abundant in the full-term placenta and widely expressed in various adult human tissues, such as the liver, skeletal muscle, heart, kidney, and pancreas. The expression of TFPI2 in tumors is inversely related to an increasing degree of malignancy, which may suggest a role for TFPI2 in the maintenance of tumor stability and inhibition of the growth of neoplasms. TFPI2 inhibits the tissue factor/factor VIIa (TF/VIIa) complex and a wide variety of serine proteinases including plasmin, plasma kallikrein, factor XIa, trypsin, and chymotrypsin. TFPI2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. TFPI2 has also been shown to induce apoptosis and inhibit angiogenesis, which may contribute significantly to tumor growth inhibition.

Full Name
tissue factor pathway inhibitor 2
References
  • Peerschke EI, et al. (2004) Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation. Thromb Haemost. 92(4): 811-9.
  • Rollin J, et al. (2005) Expression and methylation status of tissue factor pathway inhibitor-2 gene in non-small-cell lung cancer. Br J Cancer. 92(4): 775-83.
  • Chand HS, et al. (2005) Structure, function and biology of tissue factor pathway inhibitor-2. Thromb Haemost. 94(6): 1122-30.
  • Sierko E, et al. (2007) The role of tissue factor pathway inhibitor-2 in cancer biology. Semin Thromb Hemost. 33(7): 653-9.
  • TFPI2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TFPI2 cDNA ORF Clone in Cloning Vector, Mouse MG51002-G
    TFPI2 cDNA ORF Clone, Mouse, untagged MG51002-UT
    TFPI2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51002-ACGLN
    TFPI2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51002-ACG
    TFPI2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51002-ACR
    TFPI2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51002-CF
    TFPI2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51002-NF
    TFPI2 cDNA ORF Clone, Mouse, C-His tag MG51002-CH
    TFPI2 cDNA ORF Clone, Mouse, N-His tag MG51002-NH
    TFPI2 cDNA ORF Clone, Mouse, C-HA tag MG51002-CY
    TFPI2 cDNA ORF Clone, Mouse, N-HA tag MG51002-NY
    TFPI2 cDNA ORF Clone, Mouse, N-Myc tag MG51002-NM
    TFPI2 qPCR Primer Pairs, Mouse MP200966

    TFPI2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TFPI2 cDNA ORF Clone in Cloning Vector, Human HG10545-M
    TFPI2 cDNA ORF Clone, Human, untagged HG10545-UT
    TFPI2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10545-ACG
    TFPI2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10545-ACGLN
    TFPI2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10545-ANG
    TFPI2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10545-ACR
    TFPI2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10545-ANR
    TFPI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10545-CF
    TFPI2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10545-NF
    TFPI2 cDNA ORF Clone, Human, C-His tag HG10545-CH
    TFPI2 cDNA ORF Clone, Human, N-His tag HG10545-NH
    TFPI2 cDNA ORF Clone, Human, C-HA tag HG10545-CY
    TFPI2 cDNA ORF Clone, Human, N-HA tag HG10545-NY
    TFPI2 cDNA ORF Clone, Human, C-Myc tag HG10545-CM
    TFPI2 cDNA ORF Clone, Human, N-Myc tag HG10545-NM
    TFPI2 qPCR Primer Pairs, Human HP100561
    info info
    添加购物车成功! 添加购物车失败!