After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus SPN/CD43 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse SPN Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001037810.1
cDNA-Größe:1188bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus sialophorin with N terminal His tag.
Synonyme für Gene:Cd43, Ly48, Galgp, Ly-48, A630014B01Rik, Spn
Spezies:Mouse
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

Referenzen
  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
  • Size / Price
    Katalog: MG50735-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“