After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus ASM3A / SMPDL3A Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse SMPDL3A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_020561.2
cDNA-Größe:1338bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase, acid-like 3A with C terminal His tag.
Synonyme für Gene:ASM3A, ASML3, ASML3A, AI529588, 0610010C24Rik
Spezies:Mouse
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.

Referenzen
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
  • Size / Price
    Katalog: MG52271-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“