Schnelle Bestellung

Maus SLIT2 Gene ORF cDNA clone expression plasmid, C-His tag

  • Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
DatenblattBewertungenÄhnliche ProdukteProtokolle
Maus SLIT2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_178804.3
cDNA-Größe:4566bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus slit homolog 2 (Drosophila) with C terminal His tag.
Synonyme für Gene:Slil3, Drad-1, KIAA4141, mKIAA4141, E030015M03Rik, E130320P19Rik, Slit2
Spezies:Mouse
Vektor:pCMV3-C-His
Plasmid:pCMV3-mSLIT2-His
Restriktionsschnittstelle:KpnI + XbaI (6kb + 4.62kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 819 C/T, 1512 T/C, 1716 C/T, 2217 T/C and 3610 A/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SLIT2 qPCR primers for gene expression analysis, MP200452 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Maus SLIT2 Gene Plasmid Map
Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: MG50443-CH
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“