SLC31A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51513-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SLC31A1 Reagents

CRO Services

Product recommended


All SLC31A1 Reagents

SLC31A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse solute carrier family 31, member 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC31A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

4930445G01Rik cDNA ORF Clone, Mouse;AI787263 cDNA ORF Clone, Mouse;AU016967 cDNA ORF Clone, Mouse;Ctr1 cDNA ORF Clone, Mouse

SLC31A1 Background Information

Full Name
solute carrier family 31 (copper transporter), member 1

SLC31A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC31A1 cDNA ORF Clone in Cloning Vector, Rat RG81631-G
SLC31A1 cDNA ORF Clone, Rat, untagged RG81631-UT
SLC31A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81631-ACG
SLC31A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81631-ACGLN
SLC31A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81631-ANG
SLC31A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81631-ACR
SLC31A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81631-ANR
SLC31A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81631-CF
SLC31A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81631-NF
SLC31A1 cDNA ORF Clone, Rat, C-His tag RG81631-CH
SLC31A1 cDNA ORF Clone, Rat, N-His tag RG81631-NH
SLC31A1 cDNA ORF Clone, Rat, C-HA tag RG81631-CY
SLC31A1 cDNA ORF Clone, Rat, N-HA tag RG81631-NY
SLC31A1 cDNA ORF Clone, Rat, C-Myc tag RG81631-CM
SLC31A1 cDNA ORF Clone, Rat, N-Myc tag RG81631-NM

SLC31A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC31A1 cDNA ORF Clone in Cloning Vector, Mouse MG51513-G
SLC31A1 cDNA ORF Clone, Mouse, untagged MG51513-UT
SLC31A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51513-ACGLN
SLC31A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51513-ACG
SLC31A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51513-ACR
SLC31A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51513-NF
SLC31A1 cDNA ORF Clone, Mouse, C-His tag MG51513-CH
SLC31A1 cDNA ORF Clone, Mouse, N-His tag MG51513-NH
SLC31A1 cDNA ORF Clone, Mouse, C-HA tag MG51513-CY
SLC31A1 cDNA ORF Clone, Mouse, N-HA tag MG51513-NY
SLC31A1 cDNA ORF Clone, Mouse, C-Myc tag MG51513-CM
SLC31A1 cDNA ORF Clone, Mouse, N-Myc tag MG51513-NM
SLC31A1 qPCR Primer Pairs, Mouse MP201397

SLC31A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC31A1 cDNA ORF Clone in Cloning Vector, Human HG18195-G
SLC31A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18195-ACGLN
info info
添加购物车成功! 添加购物车失败!