SF3B4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51448-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SF3B4 Reagents

CRO Services

Product recommended


All SF3B4 Reagents

SF3B4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse splicing factor 3b, subunit 4 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SF3B4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

Sap49 cDNA ORF Clone, Mouse;SF3b49 cDNA ORF Clone, Mouse;SF3b50 cDNA ORF Clone, Mouse

SF3B4 Background Information

Full Name
splicing factor 3b subunit 4

SF3B4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SF3B4 cDNA ORF Clone in Cloning Vector, Rat RG8A1690-U
SF3B4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1690-ACGLN

SF3B4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SF3B4 cDNA ORF Clone in Cloning Vector, Mouse MG51448-U
SF3B4 cDNA ORF Clone, Mouse, untagged MG51448-UT
SF3B4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51448-ACGLN
SF3B4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51448-ACG
SF3B4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51448-ANG
SF3B4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51448-ACR
SF3B4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51448-ANR
SF3B4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51448-CF
SF3B4 cDNA ORF Clone, Mouse, C-His tag MG51448-CH
SF3B4 cDNA ORF Clone, Mouse, N-His tag MG51448-NH
SF3B4 cDNA ORF Clone, Mouse, C-HA tag MG51448-CY
SF3B4 cDNA ORF Clone, Mouse, N-HA tag MG51448-NY
SF3B4 cDNA ORF Clone, Mouse, C-Myc tag MG51448-CM
SF3B4 cDNA ORF Clone, Mouse, N-Myc tag MG51448-NM
SF3B4 qPCR Primer Pairs, Mouse MP201332

SF3B4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SF3B4 cDNA ORF Clone in Cloning Vector, Human HG16375-G
SF3B4 cDNA ORF Clone, Human, untagged HG16375-UT
SF3B4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16375-ACG
SF3B4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16375-ACGLN
SF3B4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16375-ANG
SF3B4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16375-ACR
SF3B4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16375-ANR
SF3B4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16375-CF
SF3B4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16375-NF
SF3B4 cDNA ORF Clone, Human, C-His tag HG16375-CH
SF3B4 cDNA ORF Clone, Human, N-His tag HG16375-NH
SF3B4 cDNA ORF Clone, Human, C-HA tag HG16375-CY
SF3B4 cDNA ORF Clone, Human, N-HA tag HG16375-NY
SF3B4 cDNA ORF Clone, Human, C-Myc tag HG16375-CM
SF3B4 cDNA ORF Clone, Human, N-Myc tag HG16375-NM
SF3B4 qPCR Primer Pairs, Human HP105125
info info
添加购物车成功! 添加购物车失败!