Schnelle Bestellung

Maus ROBO4 Gene ORF cDNA clone expression plasmid, C-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus ROBO4 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_028783.2
    cDNA-Größe:3048bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus roundabout homolog 4 (Drosophila) with C terminal His tag.
    Synonyme für Gene:AI593217, 1200012D01Rik, Robo4
    Spezies:Mouse
    Vektor:pCMV3-C-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ROBO4 qPCR primers for gene expression analysis, MP201039 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Hintergrund

    Roundabout homolog 4, also known as magic roundabout and ROBO4 is a member of the immunoglobulin superfamily and ROBO family. ROBO4 is specifically expressed in endothelial cells. It is expressed at sites of angiogenesis in different tumor types. ROBO4 contains two fibronectin type-III domains and two Ig-like C2-type (immunoglobulin-like) domains. ROBO4 is the fourth identified member of the roundabout receptor family. It is the only Robo family member expressed in primary endothelial cells and that application of Slit inhibits their migration. ROBO4 is predominantly expressed in embryonic or tumor vascular endothelium and is considered important for vascular development and as a candidate tumor endothelial marker. ROBO4 is a bona fide member of the Robo family and may provide a repulsive cue to migrating endothelial cells during vascular development. ROBO4 is a receptor for Slit proteins, at least for SLIT2, and seems to be involved in angiogenesis and vascular patterning. ROBO4 may mediate the inhibition of primary endothelial cell migration by Slit proteins. Activating ROBO4 may have broad therapeutic application in diseases characterized by excessive angiogenesis and/or vascular leak.

    Referenzen
  • Huminiecki L., et al., 2002, Genomics 79:547-552.
  • Park,K.W. et al., 2003,Dev Biol. 261 (1):251-67.
  • Yoshikawa,M. et al., 2008, Protein Expr Purif. 61 (1):78-82.
  • Jones,C.A. et al., 2008, Nat Med. 14 (4):448-53.
  • Koch,A.W. et al., 2011, Dev Cell. 20 (1):33-46.
  • Size / Price
    Katalog: MG51081-CH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“