RASSF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52870-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RASSF1 Reagents

CRO Services

Product recommended


All RASSF1 Reagents

RASSF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
813 bp
Description
Full length Clone DNA of Mouse Ras association (RalGDS>AF-6) domain family member 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RASSF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

123F2 cDNA ORF Clone, Mouse;AA536941 cDNA ORF Clone, Mouse;AU044980 cDNA ORF Clone, Mouse;NORE2A cDNA ORF Clone, Mouse;Rassf1A cDNA ORF Clone, Mouse;Rassf1B cDNA ORF Clone, Mouse;Rassf1C cDNA ORF Clone, Mouse;RDA32 cDNA ORF Clone, Mouse;REH3P21 cDNA ORF Clone, Mouse

RASSF1 Background Information

Full Name
Ras association (RalGDS/AF-6) domain family member 1

RASSF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RASSF1 cDNA ORF Clone in Cloning Vector, Mouse MG52870-G
RASSF1 cDNA ORF Clone, Mouse, untagged MG52870-UT
RASSF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52870-ACGLN
RASSF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52870-ACG
RASSF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52870-ANG
RASSF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52870-ACR
RASSF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52870-ANR
RASSF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52870-CF
RASSF1 cDNA ORF Clone, Mouse, C-His tag MG52870-CH
RASSF1 cDNA ORF Clone, Mouse, N-His tag MG52870-NH
RASSF1 cDNA ORF Clone, Mouse, C-HA tag MG52870-CY
RASSF1 cDNA ORF Clone, Mouse, N-HA tag MG52870-NY
RASSF1 cDNA ORF Clone, Mouse, C-Myc tag MG52870-CM
RASSF1 cDNA ORF Clone, Mouse, N-Myc tag MG52870-NM

RASSF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RASSF1 cDNA ORF Clone in Cloning Vector, Human HG13220-G
RASSF1 cDNA ORF Clone, Human, untagged HG13220-UT
RASSF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13220-ACG
RASSF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13220-ACGLN
RASSF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13220-ANG
RASSF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13220-ACR
RASSF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13220-ANR
RASSF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13220-CF
RASSF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13220-NF
RASSF1 cDNA ORF Clone, Human, C-His tag HG13220-CH
RASSF1 cDNA ORF Clone, Human, N-His tag HG13220-NH
RASSF1 cDNA ORF Clone, Human, C-HA tag HG13220-CY
RASSF1 cDNA ORF Clone, Human, N-HA tag HG13220-NY
RASSF1 cDNA ORF Clone, Human, C-Myc tag HG13220-CM
RASSF1 cDNA ORF Clone, Human, N-Myc tag HG13220-NM
RASSF1 qPCR Primer Pairs, Human HP101790
info info
添加购物车成功! 添加购物车失败!