After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mouse Protein C natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse PROC Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001042767.1
cDNA-Größe:1383bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus protein C.
Synonyme für Gene:PC, Proc
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: MG50257-UT
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit2-3 weeksAnweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“