PWP1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52727-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PWP1 Reagents

CRO Services

Product recommended


All PWP1 Reagents

PWP1 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Description
Full length Clone DNA of Mouse PWP1 homolog (S. cerevisiae) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PWP1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

2310058A11Rik cDNA ORF Clone, Mouse;2610205J09Rik cDNA ORF Clone, Mouse;AI098170 cDNA ORF Clone, Mouse;AL022879 cDNA ORF Clone, Mouse;AV083409 cDNA ORF Clone, Mouse;AW550690 cDNA ORF Clone, Mouse

PWP1 Background Information

Full Name
PWP1 homolog, endonuclein

PWP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PWP1 cDNA ORF Clone in Cloning Vector, Mouse MG52727-G
PWP1 cDNA ORF Clone, Mouse, untagged MG52727-UT
PWP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52727-ACG
PWP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52727-ACGLN
PWP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52727-ANG
PWP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52727-ACR
PWP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52727-ANR
PWP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52727-CF
PWP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52727-NF
PWP1 cDNA ORF Clone, Mouse, C-His tag MG52727-CH
PWP1 cDNA ORF Clone, Mouse, N-His tag MG52727-NH
PWP1 cDNA ORF Clone, Mouse, C-HA tag MG52727-CY
PWP1 cDNA ORF Clone, Mouse, N-HA tag MG52727-NY
PWP1 cDNA ORF Clone, Mouse, N-Myc tag MG52727-NM
PWP1 qPCR Primer Pairs, Mouse MP202598

PWP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PWP1 cDNA ORF Clone in Cloning Vector, Human HG13329-G
PWP1 cDNA ORF Clone, Human, untagged HG13329-UT
PWP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13329-ACG
PWP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13329-ACGLN
PWP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13329-ANG
PWP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13329-ACR
PWP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13329-ANR
PWP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13329-CF
PWP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13329-NF
PWP1 cDNA ORF Clone, Human, C-His tag HG13329-CH
PWP1 cDNA ORF Clone, Human, N-His tag HG13329-NH
PWP1 cDNA ORF Clone, Human, C-HA tag HG13329-CY
PWP1 cDNA ORF Clone, Human, N-HA tag HG13329-NY
PWP1 cDNA ORF Clone, Human, C-Myc tag HG13329-CM
PWP1 cDNA ORF Clone, Human, N-Myc tag HG13329-NM
PWP1 qPCR Primer Pairs, Human HP102034
info info
添加购物车成功! 添加购物车失败!