PSMA cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50214-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMA Reagents
CRO Services
Product recommended

All PSMA Reagents
PSMA cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2259 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1752G/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse folate hydrolase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
HindIII + XbaI (6kb + 2.3kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSMA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA cDNA ORF Clone, Mouse, C-HA tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5622
PSMA cDNA ORF Clone, Mouse, C-HA tag Alternative Names
GCP2 cDNA ORF Clone, Mouse;mopsm cDNA ORF Clone, Mouse
PSMA Background Information

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
folate hydrolase (prostate-specific membrane antigen) 1
References
  • Israeli R.S., et al.,(1993), Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res. 53:227-230.
  • Su S.L., et al., (1995), Alternatively spliced variants of prostate-specific membrane antigen RNA: ratio of expression as a potential measurement of progression.Cancer Res. 55:1441-1443.
  • O'Keefe D.S., et al.,(1998), Mapping, genomic organization and promoter analysis of the human prostate-specific membrane antigen gene.Biochim. Biophys. Acta 1443:113-127.
  • PSMA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PSMA cDNA ORF Clone in Cloning Vector, Mouse MG50214-M
    PSMA cDNA ORF Clone, Mouse, untagged MG50214-UT
    PSMA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50214-ACGLN
    PSMA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50214-ACG
    PSMA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50214-ACR
    PSMA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50214-CF
    PSMA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50214-NF
    PSMA cDNA ORF Clone, Mouse, C-His tag MG50214-CH
    PSMA cDNA ORF Clone, Mouse, N-His tag MG50214-NH
    PSMA cDNA ORF Clone, Mouse, N-HA tag MG50214-NY
    PSMA cDNA ORF Clone, Mouse, C-Myc tag MG50214-CM
    PSMA cDNA ORF Clone, Mouse, N-Myc tag MG50214-NM
    PSMA qPCR Primer Pairs, Mouse MP200242

    PSMA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PSMA cDNA ORF Clone in Cloning Vector, Human HG15877-G
    PSMA cDNA ORF Clone in Cloning Vector, Human HG15876-G
    PSMA cDNA ORF Clone, Human, untagged HG15877-UT
    PSMA cDNA ORF Clone, Human, untagged HG15876-UT
    PSMA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15876-ACGLN
    PSMA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15877-ACGLN
    PSMA cDNA ORF Clone, Human, C-GFPSpark® tag HG15877-ACG
    PSMA cDNA ORF Clone, Human, C-GFPSpark® tag HG15876-ACG
    PSMA cDNA ORF Clone, Human, C-OFPSpark® tag HG15877-ACR
    PSMA cDNA ORF Clone, Human, C-OFPSpark® tag HG15876-ACR
    PSMA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15877-CF
    PSMA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15876-CF
    PSMA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15877-NF
    PSMA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15876-NF
    PSMA cDNA ORF Clone, Human, C-His tag HG15877-CH
    PSMA cDNA ORF Clone, Human, C-His tag HG15876-CH
    PSMA cDNA ORF Clone, Human, N-His tag HG15877-NH
    PSMA cDNA ORF Clone, Human, N-His tag HG15876-NH
    PSMA cDNA ORF Clone, Human, C-HA tag HG15877-CY
    PSMA cDNA ORF Clone, Human, C-HA tag HG15876-CY
    PSMA cDNA ORF Clone, Human, N-HA tag HG15876-NY
    PSMA cDNA ORF Clone, Human, N-HA tag HG15877-NY
    PSMA cDNA ORF Clone, Human, C-Myc tag HG15876-CM
    PSMA cDNA ORF Clone, Human, C-Myc tag HG15877-CM
    PSMA cDNA ORF Clone, Human, N-Myc tag HG15876-NM
    PSMA cDNA ORF Clone, Human, N-Myc tag HG15877-NM
    PSMA qPCR Primer Pairs, Human HP104466
    info info
    添加购物车成功! 添加购物车失败!