After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse PREP Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_011156.2
cDNA-Größe:2133bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus prolyl endopeptidase.
Synonyme für Gene:PEP, AI047692
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

Referenzen
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Katalog: MG50288-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“