After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mouse PRDX6 ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse PRDX6 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_007453
cDNA-Größe:675bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus peroxiredoxin 6 with N terminal His tag.
Synonyme für Gene:GPx; Aop2; CP-3; Ltw4; Ltw-4; NSGPx; ORF06; Prdx5; Brp-12; Lvtw-4; aiPLA2; 1-cysPrx; AA690119; 1-Cys Prx; 9430088D19Rik
Spezies:Mouse
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Katalog: MG51391-NH
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit
 Anweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“